Синтез олигонуклеотидов

Компания “Бигль” предлагает синтезировать олигонуклеотиды для Ваших научных и прикладных задач. Мы - единственная компания в России, которая оставляет за своими клиентами выбор синтезатора, на котором будет выполнен Ваш заказ. В нашем распоряжении находятся автоматические синтезаторы нуклеиновых кислот ASM - 800, ASM - 2000. Мы используем только высококачественные реактивы ведущих западных компаний, что гарантирует высочайшую точность и стабильный выход синтеза.

Олигонуклеотиды с масштабом синтеза до 20 О.Е. очищаются с помощью электрофореза в полиакриламидном геле, свыше 20 О.Е. – с помощью обращенно-фазовой высокоэффективной жидкостной хроматографии. 

По Вашему желанию мы можем провести очистку олигонуклеотидов с помощью обращенно-фазовой высокоэффективной жидкостной хроматографии (ВЭЖХ) при любом масштабе синтеза.
Мы можем предложить экспресс-синтез: в течение 1 рабочего дня мы синтезируем олигонуклеотиды и предоставляем в виде водного раствора, прошедшего упрощённую систему очистки. 

Высокое качество наших олигонуклеотидов подтверждено нашими заказчиками – ведущими научными учреждениями биологического и медицинского профиля.

При длине олигонуклеотида от 50 до 100 оснований цена на синтез увеличивается на 10%. Если Вам необходим олигонуклеотид, длина которого превышает 100 оснований, пожалуйста, свяжитесь с нами

Время исполнения заказа от 2 до 5 рабочих дней.

  • Пожелания к оформлению заказа

    Уважаемые коллеги,

    Мы будем рады выполнить любой Ваш заказ на синтез олигонуклеотидов. А чтобы сделать наше взаимодействие более эффективным, просим Вас придерживаться нескольких несложных правил при формировании заказа.

    Помните, что короткие названия (до 8 символов) лучше размещаются на этикетке и легче читаются. При этом порядковые номера (1, 2, 3…) – это не самый удачный вариант названия, особенно если в Ваших разных заказах разные праймеры имеют один и тот же номер.

    1. Не забывайте давать названия каждому из Ваших праймеров. 
    2. Последовательность праймера принято писать от 5’ к 3’ концу. Если Вы придерживаетесь этого правила, то дополнительно обозначать 5’ и 3’ концы не обязательно.
    3. Набирая последовательность праймера, пожалуйста, обращайте внимание на раскладку клавиатуры. Старайтесь не вставлять символы, набранные кириллицей в последовательность из латинских букв. Менять регистр для C и G не обязательно.
    4. Внутрь последовательности праймера лучше не вставлять символы, не имеющие непосредственного отношения к ней.
    5. Если Вам нужен модифицированный олигонуклеотид, указывайте названия модификаций и их положение.
    6. Помните, что последовательности праймеров с большим количеством повторов и вторичных структур хуже работают и синтезируются с более низким выходом.

    Пример оформления заявки на праймеры:

    Название Последовательность
    M13R CAGGAAACAGCTATGAC
    ITS 4 TCCTCCGCTTATTGATATGC
    rolBL: CAATGGATCCCAAATTGCTATTCC

    Или

    Название 5’ модификация   3’ модификация
    M13R Cy5 CAGGAAACAGCTATGAC  
    Lprx. JOE CCATTAGCCGATTGCAAACTTGCA BHQ1

    Задержек с доставкой праймеров не будет, если в своем заказе Вы укажете свой действующий контактный телефон и адрес доставки, по которому Вас (или Ваших коллег) можно застать в рабочее время.

  • Очистка

    Мы поставляем олигонуклеотиды полностью готовыми для самых сложных молекулярно-генетических и биохимических приложений. Благодаря оригинальной системе подготовки и очистки наши олигонуклеотиды обладают повышенной активностью в ферментативных реакциях и являются свободными от токсичных ионов и растворителей.

    Мы гарантируем отсутствие загрязнений нецелевыми фрагментами ДНК, в том числе, плазмидной ДНК, ДНК человека и т.д. 

    Наши олигонуклеотиды деблокированы, очищены с помощью гель-электрофореза или обращенно-фазовой высоко эффективной жидкостной хроматографии (ВЭЖХ). Олигонуклеотиды с масштабом синтеза до 20 О.Е. очищаются с помощью электрофореза в полиакриламидном геле, свыше 20 О.Е. – с помощью ВЭЖХ или на RP картриджах с применением специализированного оборудования  OPS-201. 

    По Вашему желанию мы можем провести очистку олигонуклеотидов с помощью ВЭЖХ при любом масштабе синтеза с применением специализированного оборудования.  На завершающем этапе мы проводим стадию обязательного контроля качества, включающую оценку прозрачности, отсутствие взвеси в растворе и т.п., контроль чистоты и длины целевого олигонуклеотида на ПААГ, спектрофотометрический анализ, вычисление концентрации. 

    Мы поставляем олигонуклеотиды по Вашему желанию в виде раствора (milliQ H2O) или в лиофилизованном виде.

  • Экспресс-синтез

    Если Вы ограничены во времени, мы можем предложить экспресс-синтез: в течение одного рабочего дня мы синтезируем олигонуклеотиды и предоставляем их в виде водного раствора, прошедшего упрощённую систему очистки. Такие олигонуклеотиды полностью подходят для большинства рутинных применений, например, ПЦР. 

    В нашем предложении "Экспресс-синтез" совмещена невероятная оперативность синтеза и более привлекательная по сравнению со стандартными способами подготовки олигонуклеотидов цена. 

    С ценой предложения Вы можете ознакомиться в разделе Цены.

    О возможности выбора оптимальных способов очистки для Ваших задач Вы можете проконсультироваться у нас по электронной почте или по телефонам, указанным в разделе Контакты.  

  • Стандартные олигонуклеотиды

    Мы предлагаем стандартные олигонуклеотиды по цене 200 рублей за 100мкл 100мкМ раствора

     Random hexamer (dN)6 NNNNNN 
     Oligo (dT)23  TTTTTTTTTTTTTTTTTTTTTTT
     Oligo (dT)18  TTTTTTTTTTTTTTTTTT
     Oligo (dT)13  TTTTTTTTTTTTT
     M13F (-20) 18-mer   GTAAAACGACGGCCAGTG
     M13F (-40)   GTTTTCCCAGTCACGAC
     M13R (-48) 20-mer  AGCGGATAACAATTTCACAC
     M13R (-27) 19-mer  GGAAACAGCTATGACCATG
     M13rev 20-mer   TCACACAGGAAACAGCTATGAC
     T7 20-mer   TAATACGACTCACTATAGGG
     T7 Terminator  GCTAGTTATTGCTCAGCGG
     T3  ATTAACCCTCACTAAAG
     SP6  ATTTAGGTGACACTATAGAATAC
     SP6 Sequencing Primer (15 mer)   CACATACGATTTAGG
     Lambda gt 11 forward (24-mer)   GGTGGCGACGACTCCTGGAGCCCG
     Lambda gt 11 reverse (24-mer)   TTGACACCAGACCAACTGGTAATG
     AOX1 Forward   GACTGGTTCCAATTGACAAGC
     AOX1 Reverse    GCAAATGGCATTCTGACATCC
  • Синтез сверхдлинных олигонуклеотидов

    Нашей компанией разработан оригинальный способ синтеза сверхдлинных олигонуклеотидов. Мы предлагаем услугу по синтезу олигонуклеотидов длиной 200 оснований и более. Для уточнения цены заказа контактируйте с нами.

  • Цены

    Компания “Бигль” предлагает синтезировать олигонуклеотиды для Ваших научных и прикладных задач. Мы - единственная компания в России, которая оставляет за своими клиентами выбор синтезатора, на котором будет выполнен Ваш заказ. В нашем распоряжении находятся новейшие автоматические синтезаторы ASM - 800 (Россия) и синтезатор производства Applied Biosystems. Мы используем только высококачественные реактивы ведущих западных компаний, что гарантирует высочайшую точность и стабильный выход синтеза.

    Олигонуклеотиды с масштабом синтеза до 20 О.Е. очищаются с помощью электрофореза в полиакриламидном геле, свыше 20 О.Е. – с помощью обращенно-фазовой высокоэффективной жидкостной хроматографии. 

    По Вашему желанию мы можем провести очистку олигонуклеотидов с помощью обращенно-фазовой высокоэффективной жидкостной хроматографии (ВЭЖХ) при любом масштабе синтеза.
    Мы можем предложить экспресс-синтез: в течение 1 рабочего дня мы синтезируем олигонуклеотиды и предоставляем в виде водного раствора, прошедшего упрощённую систему очистки. 

    Высокое качество наших олигонуклеотидов подтверждено нашими заказчиками – ведущими научными учреждениями биологического и медицинского профиля.

    При длине олигонуклеотида от 50 до 100 оснований цена на синтез увеличивается на 10%. Если Вам необходим олигонуклеотид, длина которого превышает 100 оснований, пожалуйста, свяжитесь с нами

    Время исполнения заказа от 2 до 5 рабочих дней.

    Шкала синтеза,
    мкмоль
    Гарантированное количество При проведении синтеза на синтезаторе ASM-800
    цена (руб./шаг)
    При проведении синтеза на синтезаторе
    Applied Biosystems
    цена (руб./шаг)
    Очистка
    Мкмоль Оптических единиц
    0,02 0,01 2 16 20 ПААГ*
    0,05 0,025 5 20 24 ПААГ
    0,1 0,05 10 35 37 ПААГ
    0,2 0,1 20 50 55 ВЭЖХ**
    0,5 0,25 50 100 120 ВЭЖХ

Доставка

Доставка по Санкт-Петербургу осуществляется БЕСПЛАТНО.
Доставка по России при заказе от 8 олигонуклеотидов БЕСПЛАТНО.

Для уточнения цены доставки по странам СНГ и России при заказе менее 8 олигонуклеотидов свяжитесь с нами по электронной почте или по телефонам, указанным в разделе Контакты.

Есть вопросы? Оставьте email, мы свяжемся с Вами!

Отправляя форму, Вы даёте своё согласие на обработку персональных данных

Последние события

загружаю

Свяжитесь с нами

Политика конфиденциальности

Санкт-Петербург16-02-2018