Стандартные олигонуклеотиды Печать

Мы предлагаем стандартные олигонуклеотиды по цене 200 рублей за 100мкл 100mM раствора

 Random hexamer (dN)6
NNNNNN 
 Oligo (dT)23 TTTTTTTTTTTTTTTTTTTTTTT
 Oligo (dT)18
 TTTTTTTTTTTTTTTTTT
 Oligo (dT)13 TTTTTTTTTTTTT
 M13F (-20) 18-mer  GTAAAACGACGGCCAGTG
 M13F (-40)  GTTTTCCCAGTCACGAC
 M13R (-48) 20-mer AGCGGATAACAATTTCACAC
 M13R (-27) 19-mer GGAAACAGCTATGACCATG
 M13rev 20-mer  TCACACAGGAAACAGCTATGAC
 T7 20-mer  TAATACGACTCACTATAGGG
 T7 Terminator GCTAGTTATTGCTCAGCGG
 T3 ATTAACCCTCACTAAAG
 SP6 ATTTAGGTGACACTATAGAATAC
 SP6 Sequencing Primer (15 mer)  CACATACGATTTAGG
 Lambda gt 11 forward (24-mer)  GGTGGCGACGACTCCTGGAGCCCG
 Lambda gt 11 reverse (24-mer)  TTGACACCAGACCAACTGGTAATG
 AOX1 Forward  GACTGGTTCCAATTGACAAGC
 AOX1 Reverse   GCAAATGGCATTCTGACATCC
 
© 2008-2011 Beagle